ID: 1108334129_1108334134

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1108334129 1108334134
Species Human (GRCh38) Human (GRCh38)
Location 13:49421566-49421588 13:49421613-49421635
Sequence CCAGAGGAGACTTGTTGAGTGCT ACCAAGGCCTCCCCTCCACATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 99} {0: 1, 1: 0, 2: 0, 3: 22, 4: 248}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!