ID: 1108344089_1108344095

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1108344089 1108344095
Species Human (GRCh38) Human (GRCh38)
Location 13:49527279-49527301 13:49527308-49527330
Sequence CCACACACAGCTGGGCAGGCCGG AGTCAAACAGCATTGGTGGATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 33, 4: 259} {0: 1, 1: 0, 2: 2, 3: 128, 4: 247}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!