ID: 1108380125_1108380132

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1108380125 1108380132
Species Human (GRCh38) Human (GRCh38)
Location 13:49847202-49847224 13:49847215-49847237
Sequence CCACAGCACAGAGCCTTGCATGA CCTTGCATGAGAGGGAGGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 50, 4: 328} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!