ID: 1108386475_1108386483

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1108386475 1108386483
Species Human (GRCh38) Human (GRCh38)
Location 13:49903908-49903930 13:49903959-49903981
Sequence CCAGAGCAGGCTGGGACTACAGG TGTATTTTTTAGTAGAGGTGGGG
Strand - +
Off-target summary No data {0: 66, 1: 3026, 2: 8145, 3: 13057, 4: 30222}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!