ID: 1108406695_1108406697

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1108406695 1108406697
Species Human (GRCh38) Human (GRCh38)
Location 13:50110696-50110718 13:50110727-50110749
Sequence CCAAGCTACAGCATTGGTGGCCA TTAATAATAATATTTTTCAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 10, 4: 92} {0: 1, 1: 1, 2: 12, 3: 177, 4: 1487}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!