ID: 1108408029_1108408035

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1108408029 1108408035
Species Human (GRCh38) Human (GRCh38)
Location 13:50124383-50124405 13:50124397-50124419
Sequence CCCCTCTCTCCCTCTGCCCACTC TGCCCACTCAAACTGCGAAAGGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 46, 3: 319, 4: 2396} {0: 1, 1: 0, 2: 1, 3: 4, 4: 85}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!