ID: 1108423769_1108423775

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1108423769 1108423775
Species Human (GRCh38) Human (GRCh38)
Location 13:50277387-50277409 13:50277408-50277430
Sequence CCTGCCAGGCCCATTTTCCTGTT TTGTAGATGAAGAAAGAGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 243} {0: 1, 1: 0, 2: 5, 3: 49, 4: 450}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!