ID: 1108425854_1108425860

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1108425854 1108425860
Species Human (GRCh38) Human (GRCh38)
Location 13:50299430-50299452 13:50299475-50299497
Sequence CCCATATACATGTACACACACAT TTCAATTTAAATAACTGAAATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 52, 3: 344, 4: 1671} {0: 1, 1: 0, 2: 8, 3: 71, 4: 748}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!