|
Left Crispr |
Right Crispr |
| Crispr ID |
1108426207 |
1108426211 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
13:50303975-50303997
|
13:50303988-50304010
|
| Sequence |
CCTTCCTCCTGCTCTCTACCCTC |
CTCTACCCTCAAGTAGGCCCTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 7, 2: 94, 3: 678, 4: 3127} |
{0: 19, 1: 160, 2: 333, 3: 437, 4: 510} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|