ID: 1108440512_1108440514

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1108440512 1108440514
Species Human (GRCh38) Human (GRCh38)
Location 13:50448445-50448467 13:50448461-50448483
Sequence CCTAGACTTGTGAGAGCTGAATA CTGAATATACAAATGGATGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 135} {0: 2, 1: 1, 2: 23, 3: 88, 4: 388}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!