ID: 1108452337_1108452341

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1108452337 1108452341
Species Human (GRCh38) Human (GRCh38)
Location 13:50579721-50579743 13:50579749-50579771
Sequence CCCGATGTAGTGACATCAGGCTC GGTCAGTTTTAAGCTGCCGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 73} {0: 1, 1: 0, 2: 0, 3: 5, 4: 52}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!