ID: 1108462251_1108462254

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1108462251 1108462254
Species Human (GRCh38) Human (GRCh38)
Location 13:50678305-50678327 13:50678320-50678342
Sequence CCTGCTTACCAAGTAGTGGATGG GTGGATGGATGTACATCTCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 65} {0: 1, 1: 0, 2: 0, 3: 6, 4: 82}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!