ID: 1108467464_1108467468

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1108467464 1108467468
Species Human (GRCh38) Human (GRCh38)
Location 13:50731091-50731113 13:50731108-50731130
Sequence CCTCTGATTGGTCACCTCCTGTG CCTGTGACCAGAGTGGTCGTCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 9, 3: 62, 4: 248} {0: 1, 1: 0, 2: 1, 3: 7, 4: 73}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!