ID: 1108467467_1108467472

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1108467467 1108467472
Species Human (GRCh38) Human (GRCh38)
Location 13:50731108-50731130 13:50731150-50731172
Sequence CCTGTGACCAGAGTGGTCGTCGG GAGTGTAACCAAGTAACCAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 36} {0: 4, 1: 16, 2: 27, 3: 29, 4: 103}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!