ID: 1108468920_1108468929

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1108468920 1108468929
Species Human (GRCh38) Human (GRCh38)
Location 13:50748562-50748584 13:50748601-50748623
Sequence CCATGCGGGTGTCCTCAGGTGAC CCTAGTCCCACCTTTTTTAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 116} {0: 1, 1: 0, 2: 0, 3: 7, 4: 138}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!