|
Left Crispr |
Right Crispr |
| Crispr ID |
1108484007 |
1108484011 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
13:50906517-50906539
|
13:50906555-50906577
|
| Sequence |
CCCACTTATAAGTTAGAACATGC |
GCGTCTGCATTCGTTTGCTGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 20, 1: 2272, 2: 9286, 3: 21523, 4: 24878} |
{0: 1, 1: 0, 2: 6, 3: 126, 4: 1080} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|