ID: 1108485346_1108485349

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1108485346 1108485349
Species Human (GRCh38) Human (GRCh38)
Location 13:50917946-50917968 13:50917960-50917982
Sequence CCATGCTCCATCTCAGTATGTTT AGTATGTTTGCTGGTCTTTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 269} {0: 1, 1: 0, 2: 1, 3: 24, 4: 259}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!