ID: 1108502908_1108502918

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1108502908 1108502918
Species Human (GRCh38) Human (GRCh38)
Location 13:51084490-51084512 13:51084512-51084534
Sequence CCTCAGCTGGACCTTGGCCTGGC CCTTGAAGGGGAAGGACGGGTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!