ID: 1108518056_1108518064

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1108518056 1108518064
Species Human (GRCh38) Human (GRCh38)
Location 13:51221552-51221574 13:51221578-51221600
Sequence CCTTCCGCCCGCCCTGCCAACTT TCCCTCTTCACCCTCCTAATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 259} {0: 1, 1: 0, 2: 3, 3: 38, 4: 463}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!