ID: 1108518913_1108518918

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1108518913 1108518918
Species Human (GRCh38) Human (GRCh38)
Location 13:51227217-51227239 13:51227255-51227277
Sequence CCTCACTATTCTAATAATTATAT ATGGAGACTCAGAGGGCACATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 39, 4: 438} {0: 1, 1: 0, 2: 0, 3: 45, 4: 410}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!