ID: 1108521077_1108521080

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1108521077 1108521080
Species Human (GRCh38) Human (GRCh38)
Location 13:51247420-51247442 13:51247450-51247472
Sequence CCCTTTCTATGGTGGTTGTAAGG GAGTTCATACATGTAGAACATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 140} {0: 1, 1: 0, 2: 0, 3: 13, 4: 148}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!