ID: 1108534424_1108534428

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1108534424 1108534428
Species Human (GRCh38) Human (GRCh38)
Location 13:51359089-51359111 13:51359108-51359130
Sequence CCACCTATAAACAATCTTGAGAA AGAACAACTTTTGGGAAAATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 167} {0: 1, 1: 0, 2: 1, 3: 28, 4: 363}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!