ID: 1108574725_1108574727

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1108574725 1108574727
Species Human (GRCh38) Human (GRCh38)
Location 13:51781496-51781518 13:51781513-51781535
Sequence CCTACACTCACGGTCGAGGTAAG GGTAAGTGCTAGAGTGCTATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 19} {0: 1, 1: 0, 2: 0, 3: 6, 4: 74}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!