|
Left Crispr |
Right Crispr |
Crispr ID |
1108599899 |
1108599904 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
13:51983410-51983432
|
13:51983438-51983460
|
Sequence |
CCCAGTCAGGGGCTTATAGATGA |
TCTCCCTGGGACAGATCACCTGG |
Strand |
- |
+ |
Off-target summary |
{0: 10, 1: 509, 2: 664, 3: 481, 4: 306} |
{0: 8, 1: 619, 2: 690, 3: 414, 4: 383} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|