ID: 1108645783_1108645784

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1108645783 1108645784
Species Human (GRCh38) Human (GRCh38)
Location 13:52426228-52426250 13:52426247-52426269
Sequence CCTGCATACATCTAATTATTCTC TCTCCTTCCTACTTCTCTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 155} {0: 1, 1: 1, 2: 4, 3: 66, 4: 464}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!