ID: 1108648160_1108648167

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1108648160 1108648167
Species Human (GRCh38) Human (GRCh38)
Location 13:52450612-52450634 13:52450633-52450655
Sequence CCCGGCCCTCCGAGGCCGCGAGC GCAGCGCGCCAGGCAGCCTGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 177} {0: 1, 1: 0, 2: 3, 3: 20, 4: 269}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!