ID: 1108671298_1108671300

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1108671298 1108671300
Species Human (GRCh38) Human (GRCh38)
Location 13:52691853-52691875 13:52691898-52691920
Sequence CCTTTCTCCATCTGTGCATTTTT CACACCAAGAGATTTTATTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 64, 4: 636} {0: 1, 1: 0, 2: 0, 3: 15, 4: 221}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!