ID: 1108676022_1108676035

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1108676022 1108676035
Species Human (GRCh38) Human (GRCh38)
Location 13:52738931-52738953 13:52738960-52738982
Sequence CCGCCGGCAGCCGCGCGCCCCTC CCGCGCTCGGGCTCCCCCTAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 55, 4: 358} {0: 1, 1: 0, 2: 1, 3: 4, 4: 50}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!