ID: 1108701455_1108701468

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1108701455 1108701468
Species Human (GRCh38) Human (GRCh38)
Location 13:52947801-52947823 13:52947837-52947859
Sequence CCCGCCCCTGCCCCTGGAGTCAG GGTGGTATACTCTGTGAGGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 9, 4: 110}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!