ID: 1108701463_1108701468

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1108701463 1108701468
Species Human (GRCh38) Human (GRCh38)
Location 13:52947812-52947834 13:52947837-52947859
Sequence CCCTGGAGTCAGGGAAGCAGAGA GGTGGTATACTCTGTGAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 61, 4: 557} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!