ID: 1108729038_1108729042

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1108729038 1108729042
Species Human (GRCh38) Human (GRCh38)
Location 13:53213823-53213845 13:53213839-53213861
Sequence CCTTCCTCCTTCTGCCTATGACG TATGACGTAGTGTTCTGTGTAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 4, 4: 66}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!