ID: 1108740078_1108740079

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1108740078 1108740079
Species Human (GRCh38) Human (GRCh38)
Location 13:53328027-53328049 13:53328053-53328075
Sequence CCTGACATCTTTCTAACTGAATT TTTCTTTTTCTTTTATTTGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 8, 2: 181, 3: 3192, 4: 18467}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!