ID: 1108800068_1108800075

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1108800068 1108800075
Species Human (GRCh38) Human (GRCh38)
Location 13:54084095-54084117 13:54084127-54084149
Sequence CCGACCACCTGCCAGTCACACAG TTGCTAGGACTGAATACCACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 78, 4: 372} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!