ID: 1108820030_1108820032

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1108820030 1108820032
Species Human (GRCh38) Human (GRCh38)
Location 13:54337034-54337056 13:54337047-54337069
Sequence CCGTGCTAAGAGATCTTAGGAAT TCTTAGGAATGAGTCATGCTGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!