ID: 1108893511_1108893513

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1108893511 1108893513
Species Human (GRCh38) Human (GRCh38)
Location 13:55293998-55294020 13:55294032-55294054
Sequence CCAGGCTACAGAAGTCTCAGGTA ATTATCAGGAACTGAAGCAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 170} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!