ID: 1108968199_1108968206

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1108968199 1108968206
Species Human (GRCh38) Human (GRCh38)
Location 13:56339190-56339212 13:56339211-56339233
Sequence CCTGAGTTACCCCACCTTTCCTG TGTGCATGGATCCTAGTGAAAGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 21, 3: 97, 4: 389} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!