ID: 1109029470_1109029476

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1109029470 1109029476
Species Human (GRCh38) Human (GRCh38)
Location 13:57174680-57174702 13:57174710-57174732
Sequence CCAAACCAGACAACCTGGAAGAA GCAACAAGTGTCAGTAAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 5, 2: 0, 3: 18, 4: 195} {0: 1, 1: 0, 2: 1, 3: 8, 4: 150}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!