ID: 1109062065_1109062067

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1109062065 1109062067
Species Human (GRCh38) Human (GRCh38)
Location 13:57632429-57632451 13:57632450-57632472
Sequence CCCATAGACTTGTGGCTCGCGTC TCGCGCGCGCACGCTGCGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 14} {0: 1, 1: 0, 2: 0, 3: 6, 4: 51}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!