|
Left Crispr |
Right Crispr |
| Crispr ID |
1109241010 |
1109241017 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
13:59888251-59888273
|
13:59888303-59888325
|
| Sequence |
CCCTCCACCATCTCAGAACACAG |
AAGTGGGCCCTCACCAGAAATGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 2, 2: 59, 3: 505, 4: 1478} |
{0: 1, 1: 4, 2: 33, 3: 104, 4: 362} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|