|
Left Crispr |
Right Crispr |
| Crispr ID |
1109292828 |
1109292837 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
13:60497131-60497153
|
13:60497167-60497189
|
| Sequence |
CCGGAAGGGTGGAAGTCAACGGC |
CGGTGAACAGCAGTGGTGGATGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 3, 2: 38, 3: 95, 4: 169} |
{0: 2, 1: 12, 2: 87, 3: 147, 4: 253} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|