ID: 1109406354_1109406356

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1109406354 1109406356
Species Human (GRCh38) Human (GRCh38)
Location 13:61905345-61905367 13:61905378-61905400
Sequence CCATAGAGCTTTTTAAAAAATCC CTTATTATCAAACGTTAGCCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 26, 4: 123}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!