ID: 1109440499_1109440501

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1109440499 1109440501
Species Human (GRCh38) Human (GRCh38)
Location 13:62365277-62365299 13:62365318-62365340
Sequence CCAACAAAAGACTCACTGTGTAG CCACCTGTTGCTCCCAGCTCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!