ID: 1109538071_1109538077

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1109538071 1109538077
Species Human (GRCh38) Human (GRCh38)
Location 13:63741419-63741441 13:63741446-63741468
Sequence CCTAAGAGCCAGTGGGGAAGAGG GGCTCTCAGTCCCTGCCTCGCGG
Strand - +
Off-target summary No data {0: 41, 1: 89, 2: 98, 3: 97, 4: 261}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!