ID: 1109538076_1109538085

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1109538076 1109538085
Species Human (GRCh38) Human (GRCh38)
Location 13:63741427-63741449 13:63741471-63741493
Sequence CCAGTGGGGAAGAGGGGCTGGCT GGTGCCTCCCGCCTCTGCGATGG
Strand - +
Off-target summary {0: 1, 1: 28, 2: 48, 3: 90, 4: 365} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!