ID: 1109611013_1109611018

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1109611013 1109611018
Species Human (GRCh38) Human (GRCh38)
Location 13:64764595-64764617 13:64764615-64764637
Sequence CCCTCTGCTCTCAATACATGCAG CAGTAATGTGGGAGACTGATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 211} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!