ID: 1109683571_1109683587

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1109683571 1109683587
Species Human (GRCh38) Human (GRCh38)
Location 13:65784301-65784323 13:65784336-65784358
Sequence CCTCCGGCGCTCCTTAGTGCCCA GCCGAGGCAGCAAGGGGCTGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 49, 4: 486}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!