ID: 1109692311_1109692314

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1109692311 1109692314
Species Human (GRCh38) Human (GRCh38)
Location 13:65909674-65909696 13:65909692-65909714
Sequence CCAAGCATCATCTGTTTACTCTG CTCTGGGAGTTTTGCCCCAGAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!