ID: 1109705874_1109705880

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1109705874 1109705880
Species Human (GRCh38) Human (GRCh38)
Location 13:66092305-66092327 13:66092327-66092349
Sequence CCTATAAAAACCCCAGACTCAGC CTGGTAGACATGACTATGGCTGG
Strand - +
Off-target summary {0: 107, 1: 253, 2: 459, 3: 490, 4: 697} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!