ID: 1109725927_1109725933

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1109725927 1109725933
Species Human (GRCh38) Human (GRCh38)
Location 13:66341787-66341809 13:66341836-66341858
Sequence CCAGAACGAGGCCATGGTCAGGG CTTGTGTCTCACTGCGCTCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 57, 4: 208} {0: 1, 1: 0, 2: 0, 3: 11, 4: 107}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!