ID: 1109734496_1109734499

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1109734496 1109734499
Species Human (GRCh38) Human (GRCh38)
Location 13:66464455-66464477 13:66464507-66464529
Sequence CCCTGCTATGAGAGAACCAGTGT GTTTATATAATTGACTTTACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 174} {0: 1, 1: 0, 2: 2, 3: 23, 4: 240}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!